hgcollins1903 hgcollins1903

02-05-2018
Chemistry

contestada

what are the similaritiws and differences vetween acid and bases

Respuesta :

X3n0Captain X3n0Captain

02-05-2018

Acids and bases are both a part of the pH scale. Acids are lower than 7, while bases are higher than 7. Acids are sour, bases are bitter.

Answer Link

Otras preguntas

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Please help with geometry!!!

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.

Solve the equation. Identify any extraneous solutions. x=sqrt2x+24 6 and 4 are both extraneous solutions. 4 is a solution to the original equation. The value –6

An element's atomic number is 64. How many protons would an atom of this element have?

stars and planets are made from gases in a

How are logos, pathos, and ethos I used in an argument

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

Help with geometry!!!