jrdancer1213 jrdancer1213
  • 02-02-2018
  • Mathematics
contestada

Help!! With 15,18,21!! Explain!!

Help With 151821 Explain class=

Respuesta :

Zoey04 Zoey04
  • 02-02-2018
I simplified the first one and I got 1.

I simplified the second one and I got,

[tex] {432a}^{10} {b}^{11} [/tex]

I simplified the third one and I got,

[tex] \frac{ {a}^{4} }{{x}^{6} } [/tex]
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
how do i find the angles on a kite?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Why were the committees of correspondence powerful?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What statement best describes a republic?
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?