sivannahperkins sivannahperkins
  • 03-07-2017
  • Mathematics
contestada

what is the solution to y-2>1

Respuesta :

estudanterosa
estudanterosa estudanterosa
  • 03-07-2017
y - 2 > 1
y > 1 + 2
y > 3

Solution = {y > 3}

:)
Answer Link
ARYANAGARWAL ARYANAGARWAL
  • 03-07-2017
y-2>1
y>2+1
y>3

y = {4, 5, 6, .....}
Answer Link

Otras preguntas

El ciclo for se compone de una condición, una variable y una operación?
Significant figures a) 1.2 x 1.3 f) 32.88 / 4.38 b) 2.16 x 1.8 g) 16.590 / 1.8 c) 1.408 x 2.2 h) 84.99 / 2.03 d) 0.021 x 0.09330 i) 0.99 / 3.4484 e) 4.3324 x 1
"The Jungle" helped lead to the creation of the Food and Drug Administration, what do you think they were created enforce?
write the equation of the line in slope-intercept form: its slope is 2 and its y-intercept is -7
need the answer for this
what is turgor? in a palisade cell
Write an email to freiend on describing about yourself
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Length of the diagonal of a square with sides 8cm is? ​
Which number sentence is true?