anitapaulareyes
anitapaulareyes anitapaulareyes
  • 05-05-2017
  • English
contestada

necesito 5 oraciones compuestas con diptongo..ayuda!

Respuesta :

Diegoj31 Diegoj31
  • 05-05-2017
en inglés o español???
Answer Link

Otras preguntas

what are the zeros of the polynomial x2+4x-12
How many 1900 galveston hurricane facts homes and buildings was destroyed?
Describe why plant cells are rigid:
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging
During translation, the mrna is read in groups of three bases. true false
Suppose that a particular artillery piece has a range r = 5710 yards . find its range in miles. use the facts that 1mile=5280ft and 3ft=1yard
Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these
Pls answer this question