ramanwaterfalls1235 ramanwaterfalls1235
  • 02-08-2022
  • Geography
contestada

A beach with a lot of sand most times of the year with just a little bit of variance would be indicative of?

Respuesta :

pawan2008
pawan2008 pawan2008
  • 03-08-2022
A beach with a lot of sand most times of the year with just a little bit of variance would be indicative of: Low energy waves hitting it all year long.
Answer Link

Otras preguntas

The Panama Canal connects what two bodies of water?
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
what is the geometric mean between 6 and 20?
Compliant is to stubborn as excited is to
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420