nnero7044 nnero7044

04-03-2022
Mathematics

contestada

10x-4_5=20 like the thing __and the number on the bottm and the other one on the top

Respuesta :

mel3351 mel3351

04-03-2022

He has 4 times the number of blocks that Betty has. Which number sentence can. Aidan use to find the number of blocks Betty has? A. 36 + 4 = _____.

Answer Link

Otras preguntas

What is and how 2x = 9

3x + y = -2 x = 2 - y

Work out this please in standard form

PLZZ HURRY!!Its due in 30 minutessss

The Spanish-American War brought all of the following changes to the United States except A. gradual involvement in world affairs the B. Alaskan Purchase C. ad

What type of reaction is shown below? a) Addition reaction b) Esterification

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

I need help!!! What is 25sin26=x? plz help

What ratio is represented in the table ? A 2:3 B 3:5 C 4:5

Use the table to write a linear function that relates y to x.