osmararodriguez osmararodriguez

04-01-2022
English

contestada

identify the tense of Alex runs two miles each day

Respuesta :

gamer7weebo gamer7weebo

04-01-2022

Answer:

I believe the answer is simple present tense, or more simply, present tense. I hope this helped :)

Answer Link

Otras preguntas

True or false? The difference between accounting and economic profit is that economic profit subtracts implicit costs, whereas account profit does not.

What organelle is number 3

Help Me!I don't understand !

3.868×10 9 =? What is this answer?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

QUESTION 25 How many H20 molecules are in 24 g H20?

Camilla entered the following group of values into the ten solver

Which of the following is the term used to describe how people perceive themselves and their relationships? A.Diversity B.Individualism C.Self-concept D.Sel

how do you solve 2x-16=3+4?

Seven is the quotient. The dividend is a multiple of 3 that is less than 30.