aneegyawali aneegyawali

02-10-2021
Mathematics

contestada

Find the H. C. F of 96 and 240 by division method
Please Helppp I am screwed

Respuesta :

Аноним Аноним

02-10-2021

Answer:

H.C.F. is 48

Step-by-step explanation:

I hope this will help u

Answer Link

Otras preguntas

Classify this triangle... sides 4 ,7, 10

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

does mercury have a magnetic field

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s

3∙(a+x), if a=8; x=−10

what does a light year measure

Your religious identity is only important for you within your family and does not matter in the public sphere.

Which two states were admitted to the united states as part of the missouri compromise?

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa

What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h