01-06-2021
Physics

contestada

When thrust is doubled, pressure is______.

Respuesta :

WyattCastorena WyattCastorena

01-06-2021

Answer:

doubled

Explanation:

When thrust is double so will the pressure I hope this helps

enjoy

Answer Link

Otras preguntas

Find the missing length indicated

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..

describe five ways to set strategy for effectively gathering patients information

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart

The learning curve describes the ________ relationship between ________ and ________

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

What is the slope of the line that contains the points (10,-3) and (8,-9)?

How did the Hellenistic kings spread Greek culture

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In what country did the zimmerman telegram originate? a. germany c. russia b. france d. italy