hollywoodmya521 hollywoodmya521

01-04-2021
Physics

contestada

A slide projector has a magnification of 50. How wide will the projected image be if the slide is 2.8 cm wide?

Respuesta :

Аноним Аноним

01-04-2021

Answer:

hi = 12mm or 1.2cm

Explanation:

XOXO

Kit ^w^

Answer Link

Otras preguntas

Find the volume of the sphere. Round your answer to the nearest tenth. O 33.5 O 25.1 O16.8 O 10.7

Solve for x: −2x − 4 > 8

What type of reaction is shown? PbO2 --> PbO + O2 * O Synthesis Decomposition Cationic Single Replacement ооооооо O Anionic Single Replacement Double Replace

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What is p−m ÷ p−n equal to

Which of the following is the graph of y=3 sec [ 2(x-pi/2)] + 2

What is one purpose of writing a business plan before entering the market?

Which leader united the Greek states? Alexander the Great or Philip II ?

Livermore Industries uses a kanban system to manage production of the KR-9 subassembly. In a ten-hour day, they use 1500 units and use containers that can hold

The new office building downtown has 3 large concrete cylindrical columns in front.The columns are 20 feet tall with a diameter of 4 feet.About how much concret