kaylanikiork kaylanikiork
  • 02-10-2020
  • Mathematics
contestada

What is the value of x in the equation below?
11.9 - 0.8x = 4.5
A
--6.6
B
9.25
С
17.2
D
20.5

Respuesta :

aem103 aem103
  • 02-10-2020

Answer: B 9.25

Step-by-step explanation:

Answer Link

Otras preguntas

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Need help on this geometry please someone ?
Given that A=xy find the percentage increase in A when both X and Y increase by 10%
The actions of the pueblo indians at santa fe in 1680 can best be described as:
What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?
In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?
stars and planets are made from gases in a
Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more
why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?