larkinseric917 larkinseric917

01-10-2020
Mathematics

contestada

evaluate the expression of x=2 and y=4.
4x+3y

Respuesta :

ricchad ricchad

01-10-2020

Answer:

20

Step-by-step explanation:

x=2 and y=4.

4x+3y

= 4(2) + 3(4)

= 8 + 12

= 20

Answer Link

Otras preguntas

A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th

What is the value of x?

How did the triple alliance and the triple entente change during the war?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what does a light year measure

With this sole proprietorship, who pays the taxes?

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

Check the area that applies to a mesomorph body type. select one: a. trim waist b. trouble losing weight c. stoop-shouldered d. short heavy legs