hmwsjkIoneysasha hmwsjkIoneysasha

02-06-2016
Geography

contestada

Which type of rock is formed from the cooling and hardening of molten material?
a. igneous
b. sedimentary
c. metamorphic

Respuesta :

02-06-2016

Answer- Igneous rocks

Answer Link

Otras preguntas

What is the tube that connects the mouth and nasal cavity to the lungs

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Need Help ASAP Please). Story " A Modern Love Letter" How does the author of " A Modern Love Letter" create surprise? Cite examples of how the author's choices

Who was Charlemagne's father

which phrase best describes a period on the periodic table?

determine the slope of the line given the graph 3,-3 and 0,2

why should students be assessed on their grades only? (It’s an argument essay pls two reasons!!)

Please help! In computer science, what is the name for a series of steps used to solve a problem? Algorithm Coding Processing Programming

3.)Most people celebrate the New Year on January 1.When do other people celebrate the New Year? 4.)What is the heart a symbol of? 5.)Where do you usually see po

A boy and a sled sitting at the top of a hill a) potential energy b) kinetic energy