bookyanna7owjs8z
bookyanna7owjs8z bookyanna7owjs8z
  • 03-06-2019
  • Mathematics
contestada

A 4-PINT carton of ice cream costs $12.04. What is the price per QUART

Respuesta :

musiclover10045
musiclover10045 musiclover10045
  • 03-06-2019

1 quart = 2 pints.

This means a 4 pint container is 2 quarts.

To find the price for 1 quart divide the price by 2:

12.04 / 2 = $6.02 per quart.

Answer Link

Otras preguntas

The Panama Canal connects what two bodies of water?
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
does radiation need a phase of matter to travel with?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Is 5/7 greater than 4/6
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October