jeff609 jeff609
  • 02-06-2019
  • History
contestada

What was an effect of the US increase in production during world war two

Respuesta :

hevennnn hevennnn
  • 02-06-2019
America's involvement in World War II had a significant impact on the economy and workforce of the United States. The United States was still recovering from the impact of the Great Depression and the unemployment rate was hovering around 25%. Our involvement in the war soon changed that.
Answer Link

Otras preguntas

Step by step directions Square root for 480
what is the lcd of 10/11,29/44
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
Why was wilson not able to finish his speaking tour
What are the factors of 6x + 24?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
accurate estimation 719-348
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5