benjuh1743 benjuh1743
  • 03-09-2018
  • Social Studies
contestada

A candidate for the house of representatives is required to be a citizen for at least how long?

Respuesta :

LUVstitchy LUVstitchy
  • 03-09-2018
////“7 years”/////////
Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
why is it critical to your cells to be near capillaries
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Help pl0x, Algebra 1
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
how can you write 0.45 as fraction and a percentage ,please show work
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your